WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00025385 Gene Name  Cbr-smc-5
Sequence Name  ? CBG02311 Organism  Caenorhabditis briggsae
Automated Description  Predicted to enable ATP binding activity and ATP hydrolysis activity. Predicted to be involved in double-strand break repair via homologous recombination. Predicted to be part of Smc5-Smc6 complex. Is an ortholog of C. elegans smc-5. In C. elegans, smc-5 is involved in meiotic DNA double-strand break processing involved in reciprocal meiotic recombination. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG02311.1 CBG02311.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG02311 CBG02311   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG02311, AAAGTTTTCGATATTATGGTCGGATTGTGGAATGGAACGAGTGGAACTCTCACAAAGACT, WBGene00025385   Expr1059306 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term