WormMine: Gene WBGene00214634

• WormBase Gene ID: WBGene00214634
• Gene Name: CJA38787
• Sequence Name: CJA38787
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans bub-3. In C. elegans, bub-3 is involved in embryo development; meiotic spindle assembly checkpoint signaling; and mitotic spindle assembly checkpoint signaling.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA38787.1	CJA38787.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA38787	CJA38787		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086554
• Remark: CJA21802, CTACGACGTCGGAAAGTTGGGCGAGATTAGCGAAAAACTCGCGTTCAGTCATGGAAAACC, WBGene00177374
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term