WormMine: Gene WBGene00028938

• WormBase Gene ID: WBGene00028938
• Gene Name: Cbr-frm-10
• Sequence Name: CBG06698
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: FERM/acyl-CoA-binding protein superfamily; FERM superfamily, second domain; and Band 4.1 domain. Is an ortholog of C. elegans frm-10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06698.1	CBG06698.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06698	CBG06698		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1062263
• Remark: Cbr-frm-10, GGCTTTCATCAGAAGCAATATCGAGGAGATACTTCCAGAGCATACCTGTGAATCGATTGC, WBGene00028938
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term