WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033972 Gene Name  CBG13167
Sequence Name  ? CBG13167 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: AMP-dependent synthetase/ligase; AMP-binding enzyme; ANL, N-terminal domain; PQQ-like domain; WD40/YVTN repeat-like-containing domain superfamily; Pyrrolo-quinoline quinone beta-propeller repeat; Pyrrolo-quinoline quinone repeat; and Quinoprotein alcohol dehydrogenase-like superfamily. Is an ortholog of C. elegans W09D6.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG13167.1 CBG13167.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG13167 CBG13167   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG13167, TGGTCTTTGCTTATGGAGAACAGAATGCAAAGTTCGATTTGAGTGCTCTCCAATTTTAGC, WBGene00033972   Expr1058005 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term