WormMine: Gene WBGene00027643

• WormBase Gene ID: WBGene00027643
• Gene Name: Cbr-psf-3
• Sequence Name: CBG05113
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: GINS complex, subunit Psf3; GINS, helical bundle-like domain superfamily; GINS complex, subunit Psf3 superfamily; GINS complex protein; and GINS subunit, domain A. Is an ortholog of C. elegans psf-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05113.1	CBG05113.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05113	CBG05113		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070065
• Remark: CBG05113, GGAGGACATCGATCAGTGGCTCAGACAGGACAACAAGGGCACCAGCAAGAAGCGAAAGCG, WBGene00027643
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term