WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033993 Gene Name  CBG13198
Sequence Name  ? CBG13198 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; Ankyrin repeat; Ankyrin repeats (many copies); Domain of unknown function DUF3447; Ankyrin repeat-containing domain superfamily; and Ankyrin repeats (3 copies). Is an ortholog of C. elegans T28D6.4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG13198.1 CBG13198.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG13198 CBG13198   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG13198, TAATAATGGACGAACGGCTCTCCAGTGGGCGGCTATAAATGGTCAATCGAAAGTTGTTGA, WBGene00033993   Expr1062851 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term