WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00023756 Gene Name  CBG00355
Sequence Name  ? CBG00355 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: N-terminal domain of unknown function (DUF4140); Domain of unknown function DUF4140; Conserved hypothetical protein CHP02231; Domain of unknown function (DUF4139); and Domain of unknown function DUF4139. Is an ortholog of C. elegans C52D10.3. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG00355.1 CBG00355.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG00355 CBG00355   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG00357, GTTGGACAGGCAATTGGATCAATTGAGATGTGTCGCTGAGTATGATTCGATTAAGAGGTA, WBGene00023758   Expr1050871 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG00355, CAAGAGCTCCTCGTCTTATAAAAACTCTGCGTCACCACCAGATGCTCGTCTCAACAAAGA, WBGene00023756   Expr1062859 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term