WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00023889 Gene Name  Cbr-eif-2Bepsilon
Sequence Name  ? CBG00512 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: eIF4-gamma/eIF5/eIF2-epsilon; Nucleotide-diphospho-sugar transferases; Hexapeptide repeat; W2 domain; Armadillo-type fold; Trimeric LpxA-like superfamily; and Bacterial transferase hexapeptide (six repeats). Is an ortholog of C. elegans eif-2Bepsilon. Biotype  SO:0001217
Genetic Position 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG00512.2 CBG00512.2   [unknown]
Transcript:CBG00512.1 CBG00512.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG00512 CBG00512   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG00512, TGGCAAAAATTGCCGAATCGGAGAGAATTGTCGAATCGAATCGGCATTCATTGGAGACGA, WBGene00023889   Expr1061850 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term