WormMine: Gene WBGene00024918

• WormBase Gene ID: WBGene00024918
• Gene Name: Cbr-jmjd-1.2
• Sequence Name: CBG01727
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Jumonji helical domain; JmjC domain; Zinc finger, RING/FYVE/PHD-type; JmjC domain, hydroxylase; Jumonji, helical domain; and Zinc finger, FYVE/PHD-type. Is an ortholog of C. elegans jmjd-1.2. In C. elegans, jmjd-1.2 is involved in mitochondrial unfolded protein response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01727.1	CBG01727.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01727	CBG01727		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053243
• Remark: CBG01727, AGTCTTGTTGGGACCTTCGGAGGATCAAAAGAACGCTATACAGATGTTTAACAGTACACA, WBGene00024918
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term