WormMine: Gene WBGene00024914

• WormBase Gene ID: WBGene00024914
• Gene Name: Cbr-psr-1
• Sequence Name: CBG01722
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: JmjC domain; Cupin-like domain 8; and Cupin-like domain. Is an ortholog of C. elegans psr-1. In C. elegans, psr-1 is involved in engulfment of apoptotic cell.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01722.1	CBG01722.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01722	CBG01722		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054252
• Remark: Cbr-psr-1, TCGCTGTGGATTAGGTAACCGAAAAAGAAGAAACGATGTTTGTACTAGCGAATGTCCCGA, WBGene00024914
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term