WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00025037 Gene Name  CBG01857
Sequence Name  ? CBG01857 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Immunoglobulin-like fold; UBA-like domain; Ig-like domain from next to BRCA1 gene; Next to BRCA1, central domain; and UBA-like superfamily. Is an ortholog of C. elegans C36E6.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG01857.1 CBG01857.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG01857 CBG01857   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG01857, GAAAATATCGAGATCCGTATCACGTGCCCATTCGAGATGGGAGACTTCAAGGCGAGATTC, WBGene00025037   Expr1060199 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term