WormMine: Gene WBGene00032532

• WormBase Gene ID: WBGene00032532
• Gene Name: Cbr-sao-1
• Sequence Name: CBG11416
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: GYF-like domain superfamily and GYF domain. Is an ortholog of C. elegans sao-1. In C. elegans, sao-1 is involved in negative regulation of Notch signaling pathway and regulation of protein deneddylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11416e.1	CBG11416e.1		[unknown]
Transcript:CBG11416d.1	CBG11416d.1		[unknown]
Transcript:CBG11416a.1	CBG11416a.1		[unknown]
Transcript:CBG11416c.1	CBG11416c.1		[unknown]
Transcript:CBG11416b.1	CBG11416b.1		[unknown]

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11416e	CBG11416e		[unknown]
CDS:CBG11416a	CBG11416a		[unknown]
CDS:CBG11416b	CBG11416b		[unknown]
CDS:CBG11416c	CBG11416c		[unknown]
CDS:CBG11416d	CBG11416d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056409
• Remark: CBG11416, GTTCGTGCAAATGCCGTTCCTCCATCAAATGAACCAAAACGGTCCACCTCTGATGCACTC, WBGene00032532
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term