WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032053 Gene Name  Cbr-dyf-1
Sequence Name  ? CBG10774 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Tetratricopeptide repeat; Tetratricopeptide-like helical domain superfamily; and Tetratricopeptide repeat protein 30. Is an ortholog of C. elegans dyf-1. In C. elegans, dyf-1 is involved in intraciliary transport and protein localization to plasma membrane. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG10774b.1 CBG10774b.1   [unknown]
Transcript:CBG10774a.1 CBG10774a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG10774a CBG10774a   [unknown]
CDS:CBG10774b CBG10774b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-dyf-1, TTATTGCAAAAACGACTATTTTGGATTGGCAGCCGATGTTTTGGCGGAGAATCCACATCA, WBGene00032053   Expr1054985 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term