WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00005388 CGC Received  2003-08-19
Genotype  gcy-33(ok232) V. Laboratory  CGC
Made By  WBPerson1096 Mutagen  UV+TMP
Name  CZ3715 Outcrossed  x4
Remark  1237bp deletion in cosmid F57F5. Break points are 743 and 1980 with respect to F57F5. Sequence at the break point is: TGAGAAGTTTATAAAAAAGTA / AAACTTAAGAGTTTTCAGTCA. Primers: ok232u1: GGATTGCTTACGTGCATC; ok232d1: ATTACATTTGCAGAAACTCG; ok232d2: CTCTTCTCACTCAAATGATG. ok232u1/d1 = 322bp product with WT allele. ok232d2/u1 = 397bp product with ok232 allele. Species  Caenorhabditis elegans
Paste the following link
Lists
This Strain isn't in any lists. Upload a list.

1 Alleles

Public Name
ok232

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001553 gcy-33 F57F5.2 Caenorhabditis elegans