3 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001000 | dim-1 | C18A11.7 | Caenorhabditis elegans |
| WBGene00006836 | unc-112 | C47E8.7 | Caenorhabditis elegans |
| WBGene00013631 | Y102F5A.1 | Y102F5A.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00005872 | CGC Received | 2008-05-14 |
| Genotype | unc-112(r367) V; Y102F5A.1(ra238) dim-1(ra204) X. | Laboratory | CGC |
| Made By | WBPerson990 | Mutagen | EMS |
| Name | DM1245 | Remark | Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: URL: www.celeganskoconsortium.omrf.org. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001000 | dim-1 | C18A11.7 | Caenorhabditis elegans |
| WBGene00006836 | unc-112 | C47E8.7 | Caenorhabditis elegans |
| WBGene00013631 | Y102F5A.1 | Y102F5A.1 | Caenorhabditis elegans |
