WormMine: Gene WBGene00026207

• WormBase Gene ID: WBGene00026207
• Gene Name: Cbr-acs-20
• Sequence Name: CBG03326
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-htz-1 based on RNA-seq studies. Is predicted to encode a protein with the following domains: AMP-dependent synthetase/ligase; AMP-binding enzyme; AMP-binding enzyme, C-terminal domain; AMP-binding enzyme C-terminal domain; and ANL, N-terminal domain. Is an ortholog of C. elegans acs-20.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03326b.1	CBG03326b.1		[unknown]
Transcript:CBG03326a.1	CBG03326a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03326b	CBG03326b		[unknown]
CDS:CBG03326a	CBG03326a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-htz-1(gu167) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-htz-1(gu167)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1070152
• Remark: CBG03326, CTCTCTTACGAGCTATGCTATTCCACAGTTCATCAGAATCTGCCAAGACGTTGAGAAAAC, WBGene00026207
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term