WormMine: Gene WBGene00028374

• WormBase Gene ID: WBGene00028374
• Gene Name: Cbr-nuaf-3
• Sequence Name: CBG06029
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: NDUFAF3/Mth938 domain-containing protein; MTH938-like superfamily; and Protein of unknown function (DUF498/DUF598). Is an ortholog of C. elegans nuaf-3. In C. elegans, nuaf-3 is involved in mitochondrial respiratory chain complex I assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06029.1	CBG06029.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06029	CBG06029		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068958
• Remark: CBG06029, AAAACGATTGTGGAGTGGAGATGAGAAGAGTTGGCAATCTGCAAGGCAGAAGGTTCTCGA, WBGene00028374
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term