WormMine: Gene WBGene00024090

• WormBase Gene ID: WBGene00024090
• Gene Name: Cbr-ctns-1
• Sequence Name: CBG00747
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Lysosomal cystine transporter; PQ-loop repeat; and PQ loop repeat. Is an ortholog of C. elegans ctns-1. In C. elegans, ctns-1 is involved in L-cystine transport; lysosome organization; and phagocytosis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00747b.1	CBG00747b.1		[unknown]
Transcript:CBG00747b.2	CBG00747b.2		[unknown]
Transcript:CBG00747a.1	CBG00747a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00747a	CBG00747a		[unknown]
CDS:CBG00747b	CBG00747b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059026
• Remark: Cbr-ctns-1, GGACATCCTTCAAATGGTCCTTCAAGCGATCAATGTCAACGATTGGTCGGCGTTCTACGC, WBGene00024090
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term