WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00008302 CGC Received  2018-10-02
Genotype  smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. Laboratory  CGC
Made By  WBPerson24371 Name  HA2823
Outcrossed  x0 Remark  nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.
Species  Caenorhabditis elegans

3 Alleles

Public Name
q782
e937
rt248

1 Data Sets

Name URL
WormBaseAcedbConverter  

2 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000254 bli-4 K04F10.4 Caenorhabditis elegans
WBGene00004887 smn-1 C41G7.1 Caenorhabditis elegans