2 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000254 | bli-4 | K04F10.4 | Caenorhabditis elegans |
WBGene00004887 | smn-1 | C41G7.1 | Caenorhabditis elegans |
WormBase ID | WBStrain00008302 | CGC Received | 2018-10-02 |
Genotype | smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. | Laboratory | CGC |
Made By | WBPerson24371 | Name | HA2823 |
Outcrossed | x0 | Remark | nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000254 | bli-4 | K04F10.4 | Caenorhabditis elegans |
WBGene00004887 | smn-1 | C41G7.1 | Caenorhabditis elegans |