WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00026102 Gene Name  CBG03193
Sequence Name  ? CBG03193 Organism  Caenorhabditis briggsae
Automated Description  Is an ortholog of C. elegans F46C5.7. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG03193.1 CBG03193.1   [unknown]
Transcript:CBG03193.3 CBG03193.3   [unknown]
Transcript:CBG03193.2 CBG03193.2   [unknown]
Transcript:CBG03193.5 CBG03193.5   [unknown]
Transcript:CBG03193.4 CBG03193.4   [unknown]
Transcript:CBG03193.6 CBG03193.6   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG03193 CBG03193   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG03193, GTCTGTTGGCTCAGTGTGCTCGTCCCAATCTTCTTCGGAGAATCCATTTATATTGCCAGT, WBGene00026102   Expr1066819 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term