WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00005280 CGC Received  2003-08-19
Genotype  gcy-35(ok769) I. Laboratory  CGC
Made By  WBPerson3420 Mutagen  UV+TMP
Name  CX6448 Outcrossed  x6
Remark  668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'. Species  Caenorhabditis elegans

1 Alleles

Public Name
ok769

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001555 gcy-35 T04D3.4 Caenorhabditis elegans