1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000042 | acr-2 | K11G12.2 | Caenorhabditis elegans |
WormBase ID | WBStrain00005418 | CGC Received | 2018-05-29 |
Genotype | acr-2(n2595 n2420) X. | Laboratory | CGC |
Mutagen | EMS | Name | CZ9676 |
Outcrossed | x2 | Remark | Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. |
Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00000042 | acr-2 | K11G12.2 | Caenorhabditis elegans |