WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00007911 CGC Received  2004-02-26
Genotype  eri-1(mg366) IV. Laboratory  CGC
Made By  WBPerson315 Mutagen  EMS
Name  GR1373 Outcrossed  x5
Remark  Temperature sensitive: sterile at 25C. Maintain at 15C. Him. Eri. Due to a direct repeat the exact site and sequence of the 23 bp eri-1(mg366) insertion is unclear, however, the insertion lies in exon 6 of T07A9 between nucleotide positions 35215 and 35204 of cosmid T07A9 and includes 23 or these 32 nucleotides tttatcgaaaaaaaaacaggcactttatcgaa. Primers to follow eri-1mg366: GATAAAACTTCGGAACATATGGGGC and ACTGATGGGTAAGGAATCGAAGACG. These primers will give a 170 bp product in N2 and a 193 bp product in eri-1(mg366). Species  Caenorhabditis elegans

1 Alleles

Public Name
mg366

1 Data Sets

Name URL
WormBaseAcedbConverter  

2 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001332 eri-1 T07A9.5 Caenorhabditis elegans
WBGene00007091 eri-12 B0001.6 Caenorhabditis elegans