1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003848 | odr-1 | R01E6.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00005220 | CGC Received | 1993-12-20 |
| Genotype | odr-1(n1936) X. | Laboratory | CGC |
| Made By | WBPerson42 | Mutagen | EMS |
| Name | CX2065 | Outcrossed | x2 |
| Remark | Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.] | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003848 | odr-1 | R01E6.1 | Caenorhabditis elegans |
