WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00031320 Gene Name  Cbr-unc-47
Sequence Name  ? CBG09800 Organism  Caenorhabditis briggsae
Automated Description  Expressed in GABAergic neurons; SDQL; and SDQR. Is an ortholog of C. elegans unc-47. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09800.1 CBG09800.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09800 CBG09800   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr10561 In addition to expression in all 26 GABAergic neurons, unc-47::GFP was also sometimes expressed in two other neurons, SDQR and SDQL. Both C. elegans and C. briggsae promoters fused to GFP and introduced as extrachromosomal arrays into their endogenous environments appear to drive very weak expression in SDQR/L (about 20-fold less intense than in GABAergic neurons) in around one-third of individuals. In addition to expression in all 26 GABAergic neurons, unc-47::GFP was also sometimes expressed in two other neurons, SDQR and SDQL.Both C. elegans and C. briggsae promoters fused to GFP and introduced as extrachromosomal arrays into their endogenous environments appear to drive very weak expression in SDQR/L (about 20-fold less intense than in GABAergic neurons) in around one-third of individuals.  
Cbr-unc-47, GAATCATCATAATGGGATGCAGTGTTTGCCTTTCTGGAGTCTATTTCTCATCGATGGAAC, WBGene00031320   Expr1053705 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term