WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00005220 CGC Received  1993-12-20
Genotype  odr-1(n1936) X. Laboratory  CGC
Made By  WBPerson42 Mutagen  EMS
Name  CX2065 Outcrossed  x2
Remark  Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.] Species  Caenorhabditis elegans

1 Alleles

Public Name
n1936

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003848 odr-1 R01E6.1 Caenorhabditis elegans