WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00005003 CGC Received  2017-12-14
Genotype  npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  CGC73
Outcrossed  x0 Remark  Superficially wild-type. CRISPR/Cas9 deletion of npr-28. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: tatttcacgccttcccactctatttggtatcatttttctagccgactttc Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGATGATTGTCACAGACGTATAT
Species  Caenorhabditis elegans

1 Alleles

Public Name
umn6

1 Data Sets

Name URL
WormBaseAcedbConverter  

4 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003514 myo-2 T18D3.4 Caenorhabditis elegans
WBGene00004496 rps-27 F56E10.4 Caenorhabditis elegans
WBGene00006789 unc-54 F11C3.3 Caenorhabditis elegans
WBGene00018886 npr-28 F55E10.7 Caenorhabditis elegans