WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00006660 CGC Received  2004-11-30
Genotype  nas-37(ox199) X. Laboratory  CGC
Made By  WBPerson128 Mutagen  ENU
Name  EG199 Outcrossed  x2
Remark  At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA. Species  Caenorhabditis elegans

1 Alleles

Public Name
ox199

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003553 nas-37 C17G1.6 Caenorhabditis elegans