WormMine: Gene WBGene00037661

• WormBase Gene ID: WBGene00037661
• Gene Name: Cbr-fsn-1
• Sequence Name: CBG18196
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: B30.2/SPRY domain superfamily; F-box-like domain superfamily; F-box domain; Concanavalin A-like lectin/glucanase domain superfamily; and SPRY domain. Is an ortholog of C. elegans fsn-1. In C. elegans, fsn-1 is involved in several processes, including determination of adult lifespan; negative regulation of neuron projection development; and regulation of cell communication.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18196.2	CBG18196.2		[unknown]
Transcript:CBG18196.1	CBG18196.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18196	CBG18196		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060530
• Remark: Cbr-fsn-1, GTGCGGTCTATGGAAATACTGAAGTGACGATGGTTTACGTTGGAAGCCCACAGATGGGTT, WBGene00037661
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term