1 Genes
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00006729 | ucp-4 | K07B1.3 | Caenorhabditis elegans |
WormBase ID | WBStrain00005332 | CGC Received | 2005-09-22 |
Genotype | ucp-4(ok195) V. | Laboratory | CGC |
Made By | WBPerson696 | Mutagen | UV+TMP |
Name | CY121 | Outcrossed | x5 |
Remark | Amplify with the following external primers: EL1(agtcctgaacggagctttga); ER1(tacaatggcagcagcaagtc). Then re-amplify with the nested primer set: IL1(tcgcacattggtttgttgtt); IR1(aacggcatgagttagccaat). | Species | Caenorhabditis elegans |
WormBase Gene ID | Gene Name | Sequence Name | Organism |
---|---|---|---|
WBGene00006729 | ucp-4 | K07B1.3 | Caenorhabditis elegans |