WormMine: Gene WBGene00303390

• WormBase Gene ID: WBGene00303390
• Gene Name: CBG31431
• Sequence Name: CBG31431
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Aminotransferase class V domain; Pyridoxal phosphate-dependent transferase, small domain; Pyridoxal phosphate-dependent transferase; PP-loop family; tRNA(Ile)-lysidine/2-thiocytidine synthase, N-terminal; Aminotransferase class-V; Rossmann-like alpha/beta/alpha sandwich fold; and Pyridoxal phosphate-dependent transferase, major domain. Is an ortholog of C. elegans Y71H2B.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG31431.1	CBG31431.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG31431	CBG31431		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1051965
• Remark: CBG09825, CCCAACAGGAACTAATATTCCCAGATCTTTTCAATTCGTTAAGATCTGCTCTGAAGCCTC, WBGene00031343
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term