WormMine: Gene WBGene00023718

• WormBase Gene ID: WBGene00023718
• Gene Name: CBG00308
• Sequence Name: CBG00308
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: UV radiation resistance protein/autophagy-related protein 14; Vta1/Callose synthase, N-terminal domain superfamily; and Vacuolar sorting 38 and autophagy-related subunit 14. Is an ortholog of C. elegans T23G11.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00308a.1	CBG00308a.1		[unknown]
Transcript:CBG00308b.1	CBG00308b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00308b	CBG00308b		[unknown]
CDS:CBG00308a	CBG00308a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055793
• Remark: CBG00308, AAAATACGCGATGAGCGCTGTAGACTATGAGGATGTGAAGGCGATTCGAGAGAATTTGCA, WBGene00023718
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term