WormMine: Gene WBGene00031432

• WormBase Gene ID: WBGene00031432
• Gene Name: Cbr-alx-1
• Sequence Name: CBG09936
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: BRO1 domain superfamily; ALIX V-shaped domain; ALIX V-shaped domain binding to HIV; BRO1-like domain; and BRO1 domain. Is an ortholog of C. elegans alx-1. In C. elegans, alx-1 is involved in several processes, including endocytic recycling; endosome organization; and regulation of protein catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09936d.1	CBG09936d.1		[unknown]
Transcript:CBG09936c.1	CBG09936c.1		[unknown]
Transcript:CBG09936b.1	CBG09936b.1		[unknown]
Transcript:CBG09936a.1	CBG09936a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09936a	CBG09936a		[unknown]
CDS:CBG09936b	CBG09936b		[unknown]
CDS:CBG09936c	CBG09936c		[unknown]
CDS:CBG09936d	CBG09936d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064878
• Remark: Cbr-alx-1, GCATTCGCCCGCCAAACGGAAAAGGAGGATCTGATGAGACAGCTTCAATTGAGTATTGTT, WBGene00031432
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term