WormMine: Gene WBGene00132210

• WormBase Gene ID: WBGene00132210
• Gene Name: Cjp-lron-12
• Sequence Name: CJA13006
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: BspA type Leucine rich repeat region (6 copies); Leucine-rich repeat domain superfamily; and BspA type Leucine rich repeat region. Is an ortholog of C. elegans lron-12.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA13006.1	CJA13006.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA13006	CJA13006		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1084732
• Remark: CJA13006, AGACGAGAGTTGAAGAGAATACATTGGAGTGTAATTGTGGAATGAAATGGATGACTAGTA, WBGene00132210
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term