WormMine: Gene WBGene00119276

• WormBase Gene ID: WBGene00119276
• Gene Name: CJA00074
• Sequence Name: CJA00074
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Protein-tyrosine phosphatase-like; Myotubularin family; and Myotubularin-like phosphatase domain. Is an ortholog of C. elegans mtm-10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00074b.1	CJA00074b.1		[unknown]
Transcript:CJA00074a.1	CJA00074a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00074a	CJA00074a		[unknown]
CDS:CJA00074b	CJA00074b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083853
• Remark: CJA00074, AAAGACCACACATTATGAAATTGTCGTCGGACTTTGTGATACATGTCGGGAAAAGTTTCG, WBGene00119276
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term