WormMine: Gene WBGene00025691

• WormBase Gene ID: WBGene00025691
• Gene Name: Cbr-toe-2
• Sequence Name: CBG02682
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domain: Winged helix-like DNA-binding domain superfamily. Is an ortholog of C. elegans toe-2. In C. elegans, toe-2 is involved in positive regulation of apoptotic process and regulation of asymmetric cell division.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02682b.1	CBG02682b.1		[unknown]
Transcript:CBG02682a.1	CBG02682a.1		[unknown]
Transcript:CBG02682a.2	CBG02682a.2		[unknown]
Transcript:CBG02682c.1	CBG02682c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02682c	CBG02682c		[unknown]
CDS:CBG02682b	CBG02682b		[unknown]
CDS:CBG02682a	CBG02682a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1058151
• Remark: Cbr-toe-2, ACTTAACGCCGGTACGATTCACAGTGGCTCGAGAATCCATTAGAAAGACAGTCAACAATG, WBGene00025691
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term