WormMine: Gene WBGene00053559

• WormBase Gene ID: WBGene00053559
• Gene Name: Cre-shn-1
• Sequence Name: CRE01754
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Ankyrin repeats (3 copies); PDZ domain; PDZ domain 6; Domain of unknown function DUF3447; Ankyrin repeat; Ankyrin repeat-containing domain superfamily; Sterile alpha motif domain; SAM domain (Sterile alpha motif); PDZ superfamily; and Sterile alpha motif/pointed domain superfamily. Is an ortholog of C. elegans shn-1. In C. elegans, shn-1 is involved in defecation and rhythmic behavior.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01754.1	CRE01754.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01754	CRE01754		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1112464
• Remark: Cre-shn-1, GGTTGGCTCTCTTCATTACATCTATCAGAATATTCTCCCGCATTCCGAATTCAACGAATC, WBGene00053559
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term