WormMine: Gene WBGene00055550

• WormBase Gene ID: WBGene00055550
• Gene Name: Cre-dpff-1
• Sequence Name: CRE04507
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: DPF1-3, N-terminal; Zinc finger, FYVE/PHD-type; DPF1-3, N-terminal domain; PHD-finger; Zinc finger, PHD-finger; Zinc finger, PHD-type; and Zinc finger, RING/FYVE/PHD-type. Is an ortholog of C. elegans dpff-1. In C. elegans, dpff-1 is involved in apoptotic process; meiotic cell cycle; and response to heat.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE04507.1	CRE04507.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE04507	CRE04507		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1115756
• Remark: CRE04507, TTCGTGTCGTTTGTGCCAAATCGAGTTCGGCGATAAAGCAAGCGCCCCGGCAAAGAAATA, WBGene00055550
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term