WormMine: Gene WBGene00058536

• WormBase Gene ID: WBGene00058536
• Gene Name: Cre-slt-1
• Sequence Name: CRE15302
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Leucine rich repeat N-terminal domain; Leucine rich repeat; Leucine-rich repeat, typical subtype; Leucine Rich Repeat; Leucine rich repeat C-terminal domain; Cysteine-rich flanking region, C-terminal; Leucine-rich repeat domain superfamily; Leucine-rich repeat; and Leucine-rich repeat N-terminal domain. Is an ortholog of C. elegans slt-1. In C. elegans, slt-1 is involved in generation of neurons and regulation of neuron projection development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE15302.1	CRE15302.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE15302	CRE15302		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1116907
• Remark: Cre-slt-1, CCAACAAGAATTTGACGAGTTTTCCGAGCAGAATTCCATTTGACACTACTGAACTCTATC, WBGene00058536
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term