WormMine: Gene WBGene00057308

• WormBase Gene ID: WBGene00057308
• Gene Name: CRE11977
• Sequence Name: CRE11977
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Vacuolar protein sorting-associated protein 13; SHR-binding domain of vacuolar-sorting associated protein 13; Vacuolar protein sorting-associated protein 13, SHR-binding domain; Vacuolar-sorting-associated 13 protein C-terminal; Vacuolar protein sorting-associated protein 13, C-terminal; and Ricin B-like lectins. Is an ortholog of C. elegans C25H3.11.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE11977.1	CRE11977.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE11977	CRE11977		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1099669
• Remark: CRE11977, GTATGGTGCAGCCGGATCGAAGTCGCTCGTCGTTTGGCTGACAAAATGCAACGAGCAAAA, WBGene00057308
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term