1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00015553 | trxr-1 | C06G3.7 | Caenorhabditis elegans |
| WormBase ID | WBStrain00004800 | CGC Received | 2018-11-27 |
| Genotype | trxr-1(cer55[Sec666X]) IV. | Laboratory | CGC |
| Name | CER374 | Outcrossed | x0 |
| Remark | Missense mutation engineered by CRISPR removes a selenocysteine to place a stop codon. Resistance to cisplatin exposure. Primers to genotype the cer55 and other silent mutations: [Common Fw: #1224 GGCTTCCACATTCTCACTCC] [RV wildtype: #1414 cTTAACCTCAGCAACCAGAA] [RV Sec to STOP: #1421 CTTAACCTTAACATCCGCTG] Reference: Garca-Rodrguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6). | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00015553 | trxr-1 | C06G3.7 | Caenorhabditis elegans |
