1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00015553 | trxr-1 | C06G3.7 | Caenorhabditis elegans |
| WormBase ID | WBStrain00004799 | CGC Received | 2018-11-27 |
| Genotype | trxr-1(cer35[Sec666C]) IV. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | CER348 |
| Outcrossed | x0 | Remark | Missense mutation selenocysteine to cysteine. Resistant to cisplatin exposure. Primers to genotype this missense mutation and other silent mutations: [Common Fw: GGCTTCCACATTCTCACTCC] [RV wildtype: CTTAACCTCAGCAACCAGAA] [RV Sec to Cys: CTTAACCGCAACATCCGCTG] Reference: Garca-Rodrguez FJ, et al. Dis Model Mech. 2018 Jun 21;11(6). |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00015553 | trxr-1 | C06G3.7 | Caenorhabditis elegans |
