WormMine: Gene WBGene00027994

• WormBase Gene ID: WBGene00027994
• Gene Name: Cbr-exos-7
• Sequence Name: CBG05573
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: PNPase/RNase PH domain superfamily; Exoribonuclease, phosphorolytic domain 1; Ribosomal protein S5 domain 2-type fold; Exoribonuclease, PH domain 2 superfamily; and 3' exoribonuclease family, domain 1. Is an ortholog of C. elegans exos-7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05573b.1	CBG05573b.1		[unknown]
Transcript:CBG05573a.1	CBG05573a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05573a	CBG05573a		[unknown]
CDS:CBG05573b	CBG05573b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063982
• Remark: Cbr-exos-7, CACCGGAAGAAGAGTGTTGTATCCGATCACAGCTTCTAATTGGAGTGGCCAAAAATCTCA, WBGene00027994
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term