WormMine: Gene WBGene00026271

• WormBase Gene ID: WBGene00026271
• Gene Name: Cbr-rack-1
• Sequence Name: CBG03402
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: G-protein beta WD-40 repeat; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans rack-1. In C. elegans, rack-1 is involved in several processes, including antifungal innate immune response; cytoskeleton-dependent cytokinesis; and motor neuron axon guidance.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03402b.1	CBG03402b.1		[unknown]
Transcript:CBG03402a.1	CBG03402a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03402a	CBG03402a		[unknown]
CDS:CBG03402b	CBG03402b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	C.briggsae proteins that showed significantly increased at L4 larva stage than in emrbyo.	Benjamin and Hochberg corrected p-value < 0.05.	WBPaper00051425:CB_L4_vs_embryo_upregulated

1 Expression Patterns

• Primary Identifier: Expr1059135
• Remark: Cbr-rack-1, AAGAAGGAGATCGAAGAGCTCAAGCCAGAAATCGCCAGCTCCGGAAGCGGAAGAGGATCC, WBGene00026271
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term