WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00066880 Gene Name  Cre-srx-97
Sequence Name  ? CRE06327 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class x (Srx); Serpentine type 7TM GPCR chemoreceptor Srx; and Serpentine receptor class gamma-31. Is an ortholog of C. elegans srx-97. In C. elegans, srx-97 is involved in olfactory behavior. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE06327.1 CRE06327.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE06327 CRE06327   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE06325, CGGCGTTTTCATGATTGTGGCAAGTTCTAGAAATGTTCGATTTGCTCAATTCGTTATTTA, WBGene00079272   Expr1111150 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cre-srx-97, TCCTCCAATCTTGTTTTCAAGATTGGATATATCTTCTGGACACTATCAATAGTATGTACA, WBGene00066880   Expr1114086 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term