WormMine: Gene WBGene00124496

• WormBase Gene ID: WBGene00124496
• Gene Name: Cjp-aspm-1
• Sequence Name: CJA05292
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Calponin homology (CH) domain; IQ calmodulin-binding motif; Calponin homology domain; IQ motif, EF-hand binding site; and CH domain superfamily. Is an ortholog of C. elegans aspm-1. In C. elegans, aspm-1 is involved in establishment of meiotic spindle orientation; meiotic spindle organization; and regulation of protein localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05292.1	CJA05292.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05292	CJA05292		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073219
• Remark: Cjp-aspm-1, AAAACTGAGAAAGTCGACGCTTCATGGATTGACCAATGCTAATCTTCACTTTGTTCACCT, WBGene00124496
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term