WormMine: Gene WBGene00126297

• WormBase Gene ID: WBGene00126297
• Gene Name: CJA07093
• Sequence Name: CJA07093
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: LDL receptor-like superfamily; Low-density lipoprotein receptor domain class A; Low-density lipoprotein (LDL) receptor class A repeat; CUB domain; and Spermadhesin, CUB domain superfamily. Is an ortholog of C. elegans sol-2. In C. elegans, sol-2 is involved in several processes, including hyperosmotic response; positive regulation of glutamatergic synaptic transmission; and thigmotaxis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA07093b.1	CJA07093b.1		[unknown]
Transcript:CJA07093a.1	CJA07093a.1		[unknown]
Transcript:CJA07093a.2	CJA07093a.2		[unknown]
Transcript:CJA07093a.3	CJA07093a.3		[unknown]
Transcript:CJA07093a.4	CJA07093a.4		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA07093a	CJA07093a		[unknown]
CDS:CJA07093b	CJA07093b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1086431
• Remark: CJA07093, GATAGGAGAGGAGCGAATTGGTTTCAAAATTATCTGGACTGCAGTGGAAGGGCTTATTGG, WBGene00126297
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term