WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00177544 Gene Name  CJA21972
Sequence Name  ? CJA21972 Organism  Caenorhabditis japonica
Automated Description  Is an ortholog of C. elegans Y73E7A.5; Y47H10A.2; and Y45F10B.12. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA21972b.1 CJA21972b.1   [unknown]
Transcript:CJA21972a.1 CJA21972a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA21972b CJA21972b   [unknown]
CDS:CJA21972a CJA21972a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA21972, AATCGGATAGAATGCTAGCTACTGTACTTATCAATCATGTGCACACACTTGTTTTCGTTG, WBGene00177544   Expr1072277 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term