WormMine: Gene WBGene00062564

• WormBase Gene ID: WBGene00062564
• Gene Name: Cre-dnj-1
• Sequence Name: CRE12589
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function (DUF1977); DnaJ domain; Domain of unknown function DUF1977, DnaJ-like; and Chaperone J-domain superfamily. Is an ortholog of C. elegans dnj-1. In C. elegans, dnj-1 is involved in protein-containing complex assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE12589.1	CRE12589.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE12589	CRE12589		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1100849
• Remark: Cre-dnj-1, TTCGTATCGAGGACGGATCCGACAAGTAGAACAGCAGGTCGAGGATGATTATATTCAAAA, WBGene00062564
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term