WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00129829 Gene Name  CJA10625
Sequence Name  ? CJA10625 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: DJ-1/PfpI family; DJ-1/PfpI; Protein/nucleic acid deglycase DJ-1; and Class I glutamine amidotransferase-like. Is an ortholog of C. elegans djr-1.1 and djr-1.2. In C. elegans, djr-1.1 is involved in several processes, including cellular aldehyde metabolic process; cellular response to aldehyde; and monocarboxylic acid biosynthetic process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA10625b.1 CJA10625b.1   [unknown]
Transcript:CJA10625a.1 CJA10625a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA10625b CJA10625b   [unknown]
CDS:CJA10625a CJA10625a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA10625, GCCGCTCCTACAGTTCTAATGAGCCATGGCATCAAACCAAACTTAATCACCAGCCATCCT, WBGene00129829   Expr1075027 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA25826, GTATTGTTCCGGACGCATCTCTCGAGAGTGTCAAGAATCAAACGTTCGATCTAGTCATGT, WBGene00181398   Expr1072836 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term